![]() ![]() ![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() ![]() ![]() |
Deutsch
![]() ![]() |
![]() |
|
![]() |
![]() |
rand_seqs (version 1.01)This program randomly generates a pool of DNA sequences. At each base withinthe sequences, the probability for each of the four bases to be chosen is 0.25. See the manual for a more detailed description of this tool. Read the logfile to see what's new in this version. DownloadThe program: rand_seqs.exe (248 KB)ExampleThis tool can produce sequences like these:gtgtagtccatacatagcac tgcacgttcaacatatacat ttcgtcaacgctcgattcag atagtgtaaacttttcctca ccttttgatctaccggctgt cagacacgacgaaacgagcc last modification:
Jun/20/2008
|
![]() |
|
Imprint
![]() |
![]() ![]() |
![]() |
|
<webmaster ![]() |
The university does not accept liability for the contents of linked external internet sites![]() |