LSXI Home | Deutsch English |
|
rand_seqs (version 1.01)This program randomly generates a pool of DNA sequences. At each base withinthe sequences, the probability for each of the four bases to be chosen is 0.25. See the manual for a more detailed description of this tool. Read the logfile to see what's new in this version. DownloadThe program: rand_seqs.exe (248 KB)ExampleThis tool can produce sequences like these:gtgtagtccatacatagcac tgcacgttcaacatatacat ttcgtcaacgctcgattcag atagtgtaaacttttcctca ccttttgatctaccggctgt cagacacgacgaaacgagcc last modification:
Jun/20/2008
|
<webmaster ls11.cs.tu-dortmund.de> |
Die Universität übernimmt keine Haftung für den Inhalt verlinkter externer Internetseiten |