LSXI Home | Deutsch English |
|
thermo (version 1.01)This program reads DNA sequences and writes some thermodynamic properties tostandard output. These are melting temperature Tm, as well as differences in enthalpy Delta H, entropy Delta S, and Gibbs free energy Delta G of the hybridization reaction between each sequence and its Watson-Crick complement. The sequences are usually read from an input file. If no filename is given, thermo works in interactive mode. In this mode the user is prompted to type in a sequence, and the thermodynamic data are put out immediately. You can leave the interactive mode (and exit the program) by entering @. See the manual for a more detailed description of this tool. Read the logfile to see what's new in this version. Download
ExamplesWith input sequences like these:ttcgccctgctactaacacg agataacagcaggatttctt ggatcgcaggatctcagtca gtgaccctccttccagtccg gaattccatatcccttccaa agaccgggctccgcacctgt cttcacatacaaaattaatc gtccttcccgcggtttctac thermo produces a table like this: sequence Tm [deg C] DeltaH [kcal/mol] DeltaS [cal/K mol] DeltaG_37 [kcal/mol] ttcgccctgctactaacacg 52.3596 -151.4 -405.3 -25.29 agataacagcaggatttctt 43.7015 -141.6 -387.3 -21.58 ggatcgcaggatctcagtca 51.7963 -142.5 -379.6 -24.96 gtgaccctccttccagtccg 57.5841 -141.7 -370.1 -26.51 gaattccatatcccttccaa 44.735 -137.5 -373.5 -21.49 agaccgggctccgcacctgt 62.919 -150.2 -388.2 -29.22 cttcacatacaaaattaatc 37.2746 -143.4 -401.5 -18.77 gtccttcccgcggtttctac 55.496 -150.7 -399.1 -26.37 An interactive session may look like this: >thermo Enter sequence (@ to exit): aaaaaaaaaa Tm = 1.01574 deg C DeltaH = -66.5 kcal / mol DeltaS = -198.622 cal / K per mol DeltaG = -4.76461 kcal / mol, at 37 deg C Enter sequence (@ to exit): gcgcgcgcgc Tm = 45.7317 deg C DeltaH = -91.2 kcal / mol DeltaS = -244.822 cal / K per mol DeltaG = -15.3446 kcal / mol, at 37 deg C Enter sequence (@ to exit): @ last modification:
Dec/05/2007
|
Imprint | |
<webmaster ls11.cs.tu-dortmund.de> |
The university does not accept liability for the contents of linked external internet sites |