|
|
|
|
|
|
|
|
|
LSXI
Home
|
Deutsch
English
|
 |
|
|
|
|
gc (version 1.0)This program reads DNA or RNA sequences and writes their length (in bases),absolute GC content, and GC ratio (i.e. GC content devided by sequence length) to standard output. The sequences are usually read from an input file. If no filename is given, gc works in interactive mode. In this mode the user is prompted to type in a sequence, and the calculated data are put out immediately. You can leave the interactive mode (and exit the program) by entering @. See the manual for a more detailed description of this tool. Download
ExamplesWith input sequences like these:ttcgccctgctactaacacg agataacagcaggatttctt ggatcgcaggatctcagtca gtgaccctccttccagtccg gaattccatatcccttccaa agaccgggctccgcacctgt cttcacatacaaaattaatc gtccttcccgcggtttctac gc produces a table like this: sequence length number_GC GC_ratio gtacttccttaaacgacgcagg 22 11 0.5 ggcggtaaaagaatcttggctg 22 11 0.5 catatctcggcacacatgatgg 22 11 0.5 cttatcgctttatgaccggacc 22 11 0.5 gcttcggattaacagtgacgtg 22 11 0.5 caatgaaacactaggcgaggac 22 11 0.5 cttcacgattgccactttccac 22 11 0.5 cgtgtagcctttgtattcgtcc 22 11 0.5 An interactive session may look like this: >gc Enter sequence (@ to exit): aaaaaaaaaaa sequence length number_GC GC_ratio aaaaaaaaaaa 11 0 0 Enter sequence (@ to exit): gcgcgcgcgcg sequence length number_GC GC_ratio gcgcgcgcgcg 11 11 1 Enter sequence (@ to exit): acgugcaugaccgauca sequence length number_GC GC_ratio acggcagaccgaca 14 9 0.642857 Enter sequence (@ to exit): @ last modification:
Dec/05/2007
|
|||||||||||||||||||||||||||||
 |
|
|
Imprint
|
|
 |
|
<webmaster  ls11.cs.tu-dortmund.de>
|
The university does not accept liability for the contents of linked external internet sites
|
