Kopf
   
LSXI Home Deutsch English
menu-en
     
Molecular Computing
  Home
  Publications
  Downloads
  Links
     
Ls11 Homepage
CANADA: seq_dist2

seq_dist2 (version 1.01)

This program reads DNA sequences from an input file (which contains one sequence in
each line) and compares each possible pair of sequences with several distance measures.
Otherwise, seq_dist2 is very similar to seq_dist. The results of the comparisons are written
to standard output. You can choose whether you want all results in one big table or whether
one table for each distance measure is written.

See the manual for a more detailed description of this tool.
Read the logfile to see what's new in this version.

Download

The program: seq_dist2.exe (300 KB)
Example input files: example_seqs.txt (1 KB) example_seqs_w_IDs.txt (1 KB)

Example

With input sequences like these:

ttcgccctgctactaacacg
agataacagcaggatttctt
ggatcgcaggatctcagtca
gtgaccctccttccagtccg
gaattccatatcccttccaa
agaccgggctccgcacctgt
cttcacatacaaaattaatc
gtccttcccgcggtttctac

seq_dist2 produces a table like this:

pair    Hamming(compl.)    HMeasure    HMeasure(compl.)    HDistance    Homology(compl.)    Edit(compl.)
1,1    18    10    0    0    0.5    13
1,2    19    11    13    11    0.45    13
1,3    18    13    13    13    0.35    12
1,4    19    13    9    9    0.35    13
1,5    13    13    13    13    0.35    12
1,6    16    14    11    11    0.3    15
1,7    16    14    12    12    0.3    13
1,8    16    13    10    10    0.35    13
2,1    19    11    13    11    0.45    13
2,2    14    10    0    0    0.5    10
...

or a series of different tables like these:

Hamming(compl.)    1    2    3    4    5    6    7    8
1    18    19    18    19    13    16    16    16
2    19    14    18    16    16    14    16    15
3    18    18    14    18    17    11    15    15
4    19    16    18    14    17    16    16    16
5    13    16    17    17    18    17    14    17
6    16    14    11    16    17    14    19    15
7    16    16    15    16    14    19    14    16
8    16    15    15    16    17    15    16    10

HMeasure    1    2    3    4    5    6    7    8
1    10    11    13    13    13    14    14    13
2    11    10    13    12    11    13    12    12
3    13    13    12    12    13    11    14    13
4    13    12    12    14    14    13    15    13
5    13    11    13    14    12    12    12    14
6    14    13    11    13    12    12    15    11
7    14    12    14    15    12    15    12    14
8    13    12    13    13    14    11    14    10
...
last modification: Jun/20/2008

  
<webmaster  ls11.cs.tu-dortmund.de>
Die Universität übernimmt keine Haftung für den Inhalt verlinkter externer Internetseiten